Biomedicines | Free Full-Text | Morphometric Analysis of the Eye by Magnetic Resonance Imaging in MGST2-Gene-Deficient Mice

12
Biomedicines | Free Full-Text | Morphometric Analysis of the Eye by Magnetic Resonance Imaging in MGST2-Gene-Deficient Mice


1. Introduction

Strabismus refers to the inability of both eyes to focus on the target at the same time, which is frequently associated with reduction or loss of binocularity [1,2,3,4,5]. The causes of strabismus are varied but are usually due to a lack of coordination among extraocular muscle movements [2]. In addition, several studies indicate that different regions of the brain, including the brainstem, pons, cerebellum, cortex, visual pathways, and neurons, are associated with abnormal eye alignment and eye movement [6,7]. These findings suggest complicated processes of eye coordination. Strabismus can be divided into two main types as comitant strabismus and incomitant strabismus [1,2,3,4,5]. In comitant strabismus, the misalignment remains relatively constant regardless of the direction of gaze, and the common forms include esotropia and exotropia. Incomitant strabismus presents misalignment that varies with the direction of gaze and is caused by muscle imbalance or nerve issues [2]. Comitant strabismus is generally considered to be more common than incomitant strabismus [1,2,3,4,5].
Comitant strabismus is often seen in childhood, and it can manifest early in life or develop later. The clinical features are highly heterogeneous and largely influenced by genetic factors, such as family histories and twin consistency, as well as various prenatal and early life environmental factors, such as prematurity and poor health during pregnancy. Both genetic factors and environmental factors increase the risk of strabismus [8,9]. Since Hippocrates first observed familial strabismus, interest in genetic risk factors has increased [4]. Multiple studies have been conducted using various approaches to investigate genetic causation, which led to a growing understanding of the factors that contribute to comitant strabismus [10]. However, the exact cause can be complex and unclear, highlighting the need for different approaches to clarify and understand this prevalent disorder. In our previous research, we identified the susceptibility loci in 4q28.3 regions for comitant strabismus that comprised both esotropia and exotropia in Japanese families, and then we conducted single-nucleotide polymorphism (SNP) analyses to narrow the chromosomal loci down to a single gene in Japanese and United States. databases. We used three different linkage analyses and found that single-nucleotide polymorphisms (SNPs) with significant p-values were present only on the microsomal glutathione S-transferase 2 (MGST2) gene on chromosome 4q28.3. Our results suggest that the MGST2 gene is a potential candidate gene for strabismus susceptibility at the chromosome 4q28.3 locus [11,12].
The MGST2 gene is a member of the membrane-associated proteins in the eicosanoid and glutathione metabolism (MAPEG) family and plays an important role in cellular detoxification and defense against oxidative stress [13,14]. Its primary function is to catalyze the conjugation of reduced glutathione to electrophilic compounds, thereby facilitating the neutralization and efflux of these compounds. This detoxification process is indispensable for maintaining cellular redox homeostasis and preventing damage caused by reactive oxygen species and toxic molecules [15,16,17]. In addition, several studies have revealed that MGST2 produces leukotriene C4, a key component for intracerebral signaling involved in endoplasmic reticulum (ER) stress, oxidative DNA damage, and cell death [18]. It is indicated that MGST2 plays a role in regulating ER stress-related pathways.

To determine what role the MGST2 gene might play in the development, eye alignment, and overall morphology of the eye as possible background of comitant strabismus, we used CRISPR/Cas9 (clustered regularly interspaced short palindromic repeat/CRISPR-associated 9) technology to create MGST2 knockout (KO) mice, then utilized small animal MRI to capture three-dimensional (3D) images of eye morphology and to employ imaging techniques to visualize the intricate anatomical structures of the eye in 3D. As the design of the study, we first analyzed MGST2 KO heterozygous mice compared with the wild type (WT) in a pilot study to establish the MRI methods, and we then proceeded to compare the MGST2 KO homozygous mice with the wild type in a main study.

2. Materials and Methods

2.1. Animal and Ethics Statement

C57BL/6J mice were purchased from the commercial animal breeder, Charles River Laboratories (Yokohama, Japan). The generation of MGST2 KO mice in this study was approved by the Animal Care and Use Committee, Gunma University (approval number 17-033). All experiments and breeding of MGST2 KO mice in this study were approved by the Animal Care and Use Committee, Okayama University (approval number OKU-2021324). Animal management was performed strictly in accordance with the standards of the Department of Animal Resources, Advanced Science Research Center, Okayama University, based on the Act on Welfare and Management of Animals in Japan.

2.2. Generation of MGST2 KO Mice

We utilized the CRISPR/Cas9 system with Cas9 endonuclease and guide RNAs (gRNAs) to produce MGST2 KO mice. The target sequences of gRNAs were ACGACATTCCGGTCCCTTGTAGG(MGST2L2) and AGGGGAAAGCGTAATACAGAAGG (MGST2R2), with the protospacer adjacent motif (PAM) sequences underlined. To accomplish this, two gRNAs (1.5 μM each crRNA/tracrRNA in mixture; Integrated DNA Technologies, Coralville, IA, USA) were mixed with recombinant Cas9 protein (100 ng/μL; GeneArt Platinum Cas9 Nuclease, Thermo Fisher Scientific, Waltham, MA, USA) in Opti-MEM I (Life Technologies, Carlsbad, CA, USA). Electroporation was performed as follows [19,20]: The electroporation condition was established by connecting the electrode (LF501PT1–10; BEX, Tokyo, Japan) to the CUY21EDIT electroporator (BEX) under a stereoscopic microscope. Embryos were placed in a line between the electrode gap filled with 5 μL of Cas9/gRNAs mixture. Electroporation was performed by setting at 30 V (3 msec ON + 97 msec OFF) with seven electric pulses.

2.3. Genotyping Analysis

The genotypes were confirmed by polymerase chain reaction (PCR) using Q5 Hot Start High-Fidelity DNA Polymerase (M0493S, New England Biolabs, Ipswich, MA, USA) and the following primers: 5′-TTCTAGTAGATAGTCCTGGTACCCAAC-3′ (forward), 5′-CCACCATGCTGAAGAGACAA-3′ (reverse). The PCR amplification conditions were as follows: a first denaturation step (98 °C, 30 s), followed by 30 cycles of denaturation (98 °C, 5 s), annealing (66 °C, 10 s), and extension (72 °C, 10 s), and then a final extension step (72 °C, 2 min). Electrophoresis of PCR products was conducted on 2% agarose gels.

2.4. Sequencing Analysis

PCR products obtained in genotyping analysis were gel-purified using the QIAquick Gel extraction kit (QIAGEN, Hilden, Gerseveral) according to the standard protocol. The purified PCR products were sequenced with an oligonucleotide primer (5′-TTCTAGTAGATAGTCCTG GTACCCAAC-3′) and Big Dye Terminator v3.1 Cycle Sequencing Kit on an ABI PRIsm 3130 Genetic Analyzer (Applied Biosystem, Thermo Fisher Scientific). MGST2 sequencing was analyzed according to the NCBI Reference Sequence (NM_174995.3).

2.5. Establishment of KO Homozygous MGST2−/− Mouse Lines for the MGST2 Gene

Heterozygous F1 mice were generated by mating the heterozygous G0 mouse lines (#5, #11) and wild-type C57BL/6J. KO heterozygous MGST2+/− mouse lines were maintained by outcrossing heterozygous male mice with WT females for 3 generations. The KO homozygous MGST2−/− mouse lines were maintained in subsequent generations by crossing heterozygous siblings.

2.6. Magnetic Resonance Imaging Analysis

In the pilot study, the axis angle and eye volume of ocular morphology were determined in WT and heterozygous MGST2+/− mice. We conducted measurements on the left eye (n = 4, each), right eye (n = 4, each), and both eyes (n = 8) of the following pairs: F1 (one pair, 8-month-old, males), F1 (one pair, 7-month-old, males), F2 (one pair, 5-month-old, males), and F2 (one pair, 4-month-old, males). Detailed experimental conditions and measurements are described in our main study.

In the main study, the ocular morphology of 5-month (20-week)-old WT mice (n = 5, males) and homozygous MGST2−/− mice (n = 5, males) were analyzed by a high-resolution small animal MRI with a voxel size of 90 microns. The mice subjected to MRI analysis were from the F6 (one pair), F7 (two pairs), and F8 (two pairs) generations. They were acquired from heterozygous intercrosses and confirmed as WT and homozygous MGST2−/− mice, separately. Comparisons were made between the WT mice (n = 5) and homozygous MGST2−/− mice (n = 5). Each mouse was positioned in a prone posture on an MRI scaffold after anesthesia using a 4% concentration of isoflurane [21,22] mixed with air. The vital signs of the mice, including respiratory rate and body temperature, were carefully monitored throughout the MRI procedure to ensure that they were well-being and stable throughout the imaging session. We conducted MRI data acquisition using a 4.7 T small animal MRI system (BioSpec, Bruker BioSpin, Ettlingen, Gerseveral) equipped with a 1H transmit–receive volume coil with an inner diameter of 23 mm. The imaging sequence (horizontally acquired) was T2-weighted 3D-Turbo rapid acquisition with relaxation enhancement (TurboRARE). To obtain a complete view of the eyeball, the following imaging parameters were established: a repetition time of 1800 ms; an echo time of 60 ms; an echo train length of 13; a slice thickness of 0.09 mm, comprising 91 slices; a field of view of 20 × 20 mm; and a matrix size of 222 × 278. The multiplanar reconstruction tool (3D MAP of the Horos software (version 3.0, The Horos Project)) was used to generate horizontal, equatorial, and sagittal planes. To execute the reconstruction process, the horizontal plane was utilized as a reference plane. In the initial step, we selected an image that depicted the eye axis, spanning from the anterior corneal surface through the center of the maximum diameter of the lens approximately to the posterior pole. Subsequently, a sagittal plane was defined perpendicular to the horizontal plane that passed through the eye axis in thorough visualization analysis. The plane perpendicular to both the horizontal and sagittal planes was designated as the equatorial plane (Figure 1A). The ocular dimensions were measured on the horizontal, equatorial, and sagittal images with ImageJ software (version 1.53K, NIH, Bethesda, MD, USA).
To perform morphometric analyses of the eyeball, measurement parameters were defined as follows. The axis length and axis angle were measured from the image through the horizontal plane and sagittal plane of the eye (Figure 1B,D). The length of eye axis (line AP) was recorded as the distance spanning from the anterior corneal surface (point A) through the center of the maximum diameter of the lens to the posterior pole (point P) in approximation. Axis angle (∠APL) was measured as the angle between the eye axis (line AP) and the line orthogonal to the longitudinal fissure of the brain (line PL). Eye width (line TN) was measured as the distance between the temporal (point T) and nasal (point N) of the eye, perpendicular to the axis of the eye on horizontal plane and equatorial plane (Figure 1B,C). The volume was measured from regions of interest (ROIs) set on slices in the horizontal plane. Specifically, it was calculated by converting pixel counts from the ROIs of the entire eye, based on the image resolution. Eye height (line DV) was defined as the distance between the dorsal (point D) and ventral (point V) of the eye on the sagittal plane, which was perpendicular to the eye axis, and equatorial plane (Figure 1C,D). The cross-sectional area of the eyeball was measured in the horizontal plane, equatorial plane, and sagittal plane, correspondingly (Figure 1B–D). All measurement parameters were separately assessed on ImageJ for the left eye (n = 5, each), right eye (n = 5, each), and both eyes (n = 10).

2.7. Statistical Analysis

By considering the contribution of both eyes in binocular vision and also the possibility of magnetic field inhomogeneity between both eyes in MRI (see Section 4), we decided to combine the data from both eyes to eliminate possible variations between the left and right eyes, as well as to ensure the consistency and reliability of the acquired data. Statistical analysis for measurements of the relevant parameters was conducted by SPSS for Mac (version 28.0). In Student’s t-test, p

4. Discussion

The aim of this study was to look for the role of the MGST2 gene as a candidate strabismus-susceptibility gene in eye development, eye alignment, and overall eye morphology as possible background for the development of comitant strabismus. We measured the axis length, axis angle, width, height, area, and volume of the eyes by high-resolution small animal MRI on the MGST2 gene knockout model. The results showed that the eyes of the homozygous MGST2−/− mice were larger than those of the WT mice, although there was no change in axis length and axis angle.

The no significant differences in axis angle and axis length measurements between WT and homozygous MGST2−/− mice suggest that MGST2 might not play a substantial role in determining eye alignment. The significant increase in eye volume in homozygous MGST2−/− mice compared with WT mice indicates that the MGST2 gene may influence overall eye size. The observed changes in eye height and width contributed to this increase in eye volume. The eye area had differences in all three planes but was largest in the equatorial plane, followed by the sagittal and horizontal planes, highlighting size differences in the spatial dimensions of the eye.

MGST2 plays a key role in the synthesis of leukotriene C4 (LTC4), an important lipid mediator, which binds to its internalized receptor and triggers the translocation of NADPH oxidase 4 (NOX4) to the nucleus and perinuclear region of the cell, resulting in the generation of reactive oxygen species (ROS), oxidative damage to nuclear DNA, and induction of apoptosis and necrosis. In contrast, ER-stress-induced cell death was shown to be reduced in the kidney of MGST2 KO homozygous MGST2−/− mice [18,23]. Although ER-stress-induced apoptosis mediated by MGST2 has not been reported in eyes, the absence of MGST2 may prevent cell death that should occur during eye development and differentiation, resulting in increased eye volume. Under the circumstances, apoptosis mechanism in MGST2 KO heterozygous MGST2+/− mice remains unknown. The reason why the heterozygous MGST2+/− mice in this study did not show significant changes in the axis angle and eye volume might be possibly because they possess at least one normal copy of the MGST2 gene, which is sufficient to maintain normal development and differentiation of the eye structure.
Extrapolating these findings to the broader context of ocular morphology, it is important to note that various factors can contribute to the shape of the eye, which might be influenced by alterations in the anatomical structures of the eye, including the cornea, lens, retina, and sclera [24,25]. In this study, the result of eyeball enlargement was obtained by measuring the volume of the entire eyeball surface. There may be abnormalities in the attachment of the extraocular muscle to the sclera on the changed dimension of the eyeball surface. In that case, eye movement might be changed to some extent in the direction of action of the relevant muscles, which might lead to the development of strabismus [26]. As a methodological limitation in this study, the imaging of certain structures and tissues of the eye can be indeed dependent on the MRI conditions. Small changes in these structures may not be observable, even at higher resolution. The use of MRI contrast agents may help overcome this limitation in our future observations. MRI contrast agents are substances that can enhance the contrast and clarity of images and provide greater detail of tissue structure [27].
In cases such as myopia and hyperopia, the impact on the axis length of the eye potentially results in changes in its overall shape [28]. Indeed, it was found that most (95.7%) myopic eyes showed oblate or elongated eyeball shapes, that hyperopic eyes were predominantly oblate or broadly shaped, and that astigmatic eyes were mostly oblate or spherical [29]. The other example of a disease that contributes to such morphological changes of the eye might be glaucoma, which can cause internal expansion of the eyeball’s structure and result in an increased eyeball volume in a group of patients by elevated intraocular pressure [30]. Additionally, proptosis, or exophthalmos, is another example where changes in eye appearance, including eye enlargement, are observed without necessarily affecting the axis length or axis angle of eye [31]. Certain congenital or acquired eye disorders as well as some neurologic disorders such as elevated intracranial pressure can also lead to changes in the morphology of the eye [32,33,34,35]. These findings highlight the complexity and multifaceted nature of the factors that influence eye morphology. Although the current results in our animal model may have limitations to be directly applied to comitant strabismus, a broader understanding of the potential causes of changes in eye morphology or eye development might give a hint for the development of strabismus.
As a methodological limitation, there may be image distortion in this experiment. Because the uniformity of the main magnetic field degrades with distance from the isocenter, image distortion appears at the edges of the imageable area [36,37]. The image distortion may have caused each of the left and right eyes to be stretched or contracted on the image. Since the mice in the two groups for comparison were almost at the same age and were aligned as much as possible in terms of MRI positioning, the effect of the image distortion might be approximately equivalent among the mice. Additionally, to avoid any image distortion that may occur in the analysis, only the same eye (either the right eye or left eye) was used for comparison between the data of WT mice and MGST2 KO homozygous MGST2−/− mice. Furthermore, the TurboRARE sequence employed in this study is most insensitive to inhomogeneity of main magnetic fields among MRI pulse sequences, and thus the image distortion is minimal, and bias is limited. We also considered the participation of both eyes in binocular visual integration as well as the symmetry of the anatomical structures, and thus we decided to combine the data from the left and right eyes for analysis to reduce individual differences and to improve the reliability of the data. In this context, any existing bias might minimally impact the interpretation of morphological differences between WT and MGST2 KO homozygous MGST2−/− mice. At present, it remains to be still challenging to achieve complete uniformity in the main magnetic field of actual MRI equipment, and the image distortion cannot be avoided completely. Future studies can enhance the measurement accuracy by acquiring a main magnetic field map and by correcting image distortions in post-processing [38].
A major limitation of this study is the question of whether a mouse model might be suitable for the analysis of a clinical disease such as comitant strabismus in humans. Humans have a macular structure of the retina with a high resolution of vision. The eyes in humans are located at the front to have a wide range of the visual field, overlapping in both eyes to have binocularity. The human eyes also have a specific feature to show the cornea in the visible background of the conjunctiva to make apparent the eye position and hence the eye alignment. In contrast, mice have the eyes on each side of the head, and only their cornea, but not their conjunctiva, is visible between the eyelids, leading to difficulty in identifying the eye position and alignment. Even with these differences between the humans and mice, the mice do have binocularity with a smaller range of overlapping visual fields of both eyes. Under the circumstances, the mouse model might provide a meaningful hit or key for understanding the mechanism of comitant strabismus in humans. The extraocular muscles that attach to the eyeball might be a candidate for morphological changes in comitant strabismus [39,40]. In the case that the eyeball has a different shape, the torque exerted by the extraocular muscles might be changed, and thus the eye position might be shifted to develop comitant strabismus.

Disasters Expo USA, is proud to be supported by Inergency for their next upcoming edition on March 6th & 7th 2024!

The leading event mitigating the world’s most costly disasters is returning to the Miami Beach

Convention Center and we want you to join us at the industry’s central platform for emergency management professionals.
Disasters Expo USA is proud to provide a central platform for the industry to connect and
engage with the industry’s leading professionals to better prepare, protect, prevent, respond
and recover from the disasters of today.
Hosting a dedicated platform for the convergence of disaster risk reduction, the keynote line up for Disasters Expo USA 2024 will provide an insight into successful case studies and
programs to accurately prepare for disasters. Featuring sessions from the likes of The Federal Emergency Management Agency,
NASA, The National Aeronautics and Space Administration, NOAA, The National Oceanic and Atmospheric Administration, TSA and several more this event is certainly providing you with the knowledge
required to prepare, respond and recover to disasters.
With over 50 hours worth of unmissable content, exciting new features such as their Disaster
Resilience Roundtable, Emergency Response Live, an Immersive Hurricane Simulation and
much more over just two days, you are guaranteed to gain an all-encompassing insight into
the industry to tackle the challenges of disasters.
By uniting global disaster risk management experts, well experienced emergency
responders and the leading innovators from the world, the event is the hub of the solutions
that provide attendees with tools that they can use to protect the communities and mitigate
the damage from disasters.
Tickets for the event are $119, but we have been given the promo code: HUGI100 that will
enable you to attend the event for FREE!

So don’t miss out and register today: https://shorturl.at/aikrW

And in case you missed it, here is our ultimate road trip playlist is the perfect mix of podcasts, and hidden gems that will keep you energized for the entire journey

-

This website uses cookies to improve your experience. We'll assume you're ok with this, but you can opt-out if you wish. Accept Read More