COVID | Free Full-Text | Extraction-Free RT-PCR Surveillance Testing and Reporting for SARS-CoV-2

8
COVID | Free Full-Text | Extraction-Free RT-PCR Surveillance Testing and Reporting for SARS-CoV-2


Author Contributions

Conceptualization, P.R.C., T.D. (Tyler Duellman), L.F.-R. and J.H.; data curation, P.R.C., T.D. (Tyler Duellman) and L.T.; formal analysis, P.R.C., T.D. (Tyler Duellman) and L.F.-R.; funding acquisition, C.K., C.A.B. and J.H.; investigation, P.R.C., T.D. (Tyler Duellman), J.-Y.C., L.W., M.Z. and J.S.; methodology, P.R.C., T.D. (Tyler Duellman) and S.S.-B.; project administration, K.T., T.M., T.D. (Tamra Dagnon), B.G., C.K. and J.H.; software, M.T., M.F. and M.B.; supervision, T.M., T.D. (Tamra Dagnon), B.G., S.S.-B., C.K., P.K., C.A.B. and J.H.; validation, P.R.C. and T.D. (Tyler Duellman); visualization, P.R.C., K.T. and C.R.; writing—original draft, P.R.C.; writing—review and editing, P.R.C. and T.D. (Tyler Duellman). All authors have read and agreed to the published version of the manuscript.

Figure 1.
Testing process. This schematic depicts the extraction-free surveillance testing workflow we developed. Briefly, the participant registered the testing kit to their campus ID using the QR code provided and their mobile device, self-collected a nasal specimen, placed it in a screw-cap tube containing 1 mL of PBS, and then submitted their test. The samples were handled in a biological safety cabinet and heat-inactivated at 70 °C for 30 min. A 3 µL sample was then added directly to the qRT-PCR Mastermix in a 384-well plate, which was run on a Quantstudio 7 Pro platform. Data analysis was performed, and a .csv file was uploaded with sample ID and an interpretation of “No Action Needed” for negative tests or “Referral” for positive tests, or tests where the internal control failed. The test results were then matched to the campus ID and the email of the participant who registered the test, and the result was sent by email. The entire process was intended to be completed in 6–8 h, and the capacity can be easily increased with the use of robotics for sample handling. The figure was created with BioRender.com.

Figure 1.
Testing process. This schematic depicts the extraction-free surveillance testing workflow we developed. Briefly, the participant registered the testing kit to their campus ID using the QR code provided and their mobile device, self-collected a nasal specimen, placed it in a screw-cap tube containing 1 mL of PBS, and then submitted their test. The samples were handled in a biological safety cabinet and heat-inactivated at 70 °C for 30 min. A 3 µL sample was then added directly to the qRT-PCR Mastermix in a 384-well plate, which was run on a Quantstudio 7 Pro platform. Data analysis was performed, and a .csv file was uploaded with sample ID and an interpretation of “No Action Needed” for negative tests or “Referral” for positive tests, or tests where the internal control failed. The test results were then matched to the campus ID and the email of the participant who registered the test, and the result was sent by email. The entire process was intended to be completed in 6–8 h, and the capacity can be easily increased with the use of robotics for sample handling. The figure was created with BioRender.com.

Covid 03 00075 g001

Figure 2.
Sample collection kit. (A) The sample collection kit is pictured. The entire kit was delivered in a plastic bag with a QR code and a unique test ID, which allowed the user to register the kit by going toa designated URL. The kit consists of a flocked nasal swab, a 1.5 mL screw-cap tube pre-filled with 1 mL of sterile PBS, a test kit content insert, and an absorbent pad in the event of sample spilling. (B) The nasal swab collection instructions contain clear imagery and instructions to show the participant exactly how to register the kit and self-collect their nasal specimen. The instructions are also available in other languages. The figure was created with BioRender.com.

Figure 2.
Sample collection kit. (A) The sample collection kit is pictured. The entire kit was delivered in a plastic bag with a QR code and a unique test ID, which allowed the user to register the kit by going toa designated URL. The kit consists of a flocked nasal swab, a 1.5 mL screw-cap tube pre-filled with 1 mL of sterile PBS, a test kit content insert, and an absorbent pad in the event of sample spilling. (B) The nasal swab collection instructions contain clear imagery and instructions to show the participant exactly how to register the kit and self-collect their nasal specimen. The instructions are also available in other languages. The figure was created with BioRender.com.

Covid 03 00075 g002

Figure 3.
Testing kit registration and testing result workflow. (A) A mockup of the self-screen registration page is shown on a mobile device with a welcome screen to register the kit and a confirmation screen to link the scanned kit to the user’s ID, along with preliminary instructions on what follow-up may be required. (B) The self-screen workflow is depicted, showing how samples were linked to user identifiers. The University Health Services (UHS) was notified of the results to verify individuals needing follow-up, and emails were sent to the user with instructions that indicate if follow-up is necessary. The figure was created with BioRender.com.

Figure 3.
Testing kit registration and testing result workflow. (A) A mockup of the self-screen registration page is shown on a mobile device with a welcome screen to register the kit and a confirmation screen to link the scanned kit to the user’s ID, along with preliminary instructions on what follow-up may be required. (B) The self-screen workflow is depicted, showing how samples were linked to user identifiers. The University Health Services (UHS) was notified of the results to verify individuals needing follow-up, and emails were sent to the user with instructions that indicate if follow-up is necessary. The figure was created with BioRender.com.

Covid 03 00075 g003

Figure 4.
Development of the multiplex SARS-CoV-2 assay. Our SARS-CoV-2 multiplex assay was developed based on the primer/probe set recommended by the CDC for ease of obtaining Emergency Use Authorization if needed. (A) The primer/probe sets utilized showed similar detection of viral nucleocapsid targets (N1 and N2) and the human control target (RP) over a dilution series of positive control SARS-CoV-2 nucleocapsid plasmid, with a background of 30,000 copies/µL RP plasmid. (B) Repeat testing of the multiplex assay with more physiologically relevant positive controls, including synthetic RNA (Twist Biosciences) and the heat-inactivated virus (ATCC), showed detection of viral genetic material over a dilution series. Of note, we observed that Twist synthetic RNA degraded faster in solution than the inactive viral samples, which may account for the slightly higher Ct values shown.

Figure 4.
Development of the multiplex SARS-CoV-2 assay. Our SARS-CoV-2 multiplex assay was developed based on the primer/probe set recommended by the CDC for ease of obtaining Emergency Use Authorization if needed. (A) The primer/probe sets utilized showed similar detection of viral nucleocapsid targets (N1 and N2) and the human control target (RP) over a dilution series of positive control SARS-CoV-2 nucleocapsid plasmid, with a background of 30,000 copies/µL RP plasmid. (B) Repeat testing of the multiplex assay with more physiologically relevant positive controls, including synthetic RNA (Twist Biosciences) and the heat-inactivated virus (ATCC), showed detection of viral genetic material over a dilution series. Of note, we observed that Twist synthetic RNA degraded faster in solution than the inactive viral samples, which may account for the slightly higher Ct values shown.

Covid 03 00075 g004

Figure 5.
Matrix testing and optimization of the Mastermix and sample volume. (A) Optimization of the multiplex SARS-CoV-2 involved testing the assay performance in water, PBS, and saliva, showing similar detection in all three solutions at 100,000 copies of heat-inactivated SARS-CoV-2 virus (ATCC). Based on these data, we proceeded with a PBS-based nasal swab test as it maintained similar detection of the sample in water and was easier and safer for us to collect, inactivate, and test. (B) After selecting a PBS-based assay, we optimized the amount of sample added to the qRT-PCR reaction. The N1 primer/probe set performed well across all conditions, but there were some signal issues with the N2 primer/probe set with high sample input. We decided to stick with the 3 µL sample input, as this yielded the lowest average Ct values across primer/probe sets and might allow for plenty of residual sample for repeat testing, variant testing, and sequencing. (C) We also optimized the amount of Taqpath Mastermix added to the reaction and determined that 3 µL of Taqpath produced optimal Ct values across primer/probe sets.

Figure 5.
Matrix testing and optimization of the Mastermix and sample volume. (A) Optimization of the multiplex SARS-CoV-2 involved testing the assay performance in water, PBS, and saliva, showing similar detection in all three solutions at 100,000 copies of heat-inactivated SARS-CoV-2 virus (ATCC). Based on these data, we proceeded with a PBS-based nasal swab test as it maintained similar detection of the sample in water and was easier and safer for us to collect, inactivate, and test. (B) After selecting a PBS-based assay, we optimized the amount of sample added to the qRT-PCR reaction. The N1 primer/probe set performed well across all conditions, but there were some signal issues with the N2 primer/probe set with high sample input. We decided to stick with the 3 µL sample input, as this yielded the lowest average Ct values across primer/probe sets and might allow for plenty of residual sample for repeat testing, variant testing, and sequencing. (C) We also optimized the amount of Taqpath Mastermix added to the reaction and determined that 3 µL of Taqpath produced optimal Ct values across primer/probe sets.

Covid 03 00075 g005

Table 1.
SARS-CoV-2 multiplex assay reagents.

Table 1.
SARS-CoV-2 multiplex assay reagents.

Primer/Probe Name Sequence (5′→3′)
2019-nCoV_N1-FWD GACCCCAAAATCAGCGAAAT
2019-nCoV_N1-REV TCTGGTTACTGCCAGTTGAATCTG
2019-nCoV_N1-ABY ABY-ACCCCGCATTACGTTTGGTGGACC-QSY
2019-nCoV_N2-FWD TTACAAACATTGGCCGCAAA
2019-nCoV_N2-REV GCGCGACATTCCGAAGAA
2019-nCoV_N2-FAM FAM-ACAATTTGCCCCCAGCGCTTCAG-QSY
RP-FWD AGATTTGGACCTGCGAGCG
RP-FEV GAGCGGCTGTCTCCACAAGT
RP-VIC VIC-TTCTGACCTGAAGGCTCTGCGCG-QSY

Table 2.
Presence/absence call settings.

Table 2.
Presence/absence call settings.

Presence Targets Absence Targets Call Assessment
N1, N2, RP Presence Referral
N1 N2, RP Presence Referral
N2 N1, RP Presence Referral
N1, RP N2 Presence Referral
N2, RP N1 Presence Referral
N1, N2 RP Presence Referral
N1, N2, RP Inconclusive Referral
RP N1, N2 Absence No Action Needed

Disasters Expo USA, is proud to be supported by Inergency for their next upcoming edition on March 6th & 7th 2024!

The leading event mitigating the world’s most costly disasters is returning to the Miami Beach

Convention Center and we want you to join us at the industry’s central platform for emergency management professionals.
Disasters Expo USA is proud to provide a central platform for the industry to connect and
engage with the industry’s leading professionals to better prepare, protect, prevent, respond
and recover from the disasters of today.
Hosting a dedicated platform for the convergence of disaster risk reduction, the keynote line up for Disasters Expo USA 2024 will provide an insight into successful case studies and
programs to accurately prepare for disasters. Featuring sessions from the likes of The Federal Emergency Management Agency,
NASA, The National Aeronautics and Space Administration, NOAA, The National Oceanic and Atmospheric Administration, TSA and several more this event is certainly providing you with the knowledge
required to prepare, respond and recover to disasters.
With over 50 hours worth of unmissable content, exciting new features such as their Disaster
Resilience Roundtable, Emergency Response Live, an Immersive Hurricane Simulation and
much more over just two days, you are guaranteed to gain an all-encompassing insight into
the industry to tackle the challenges of disasters.
By uniting global disaster risk management experts, well experienced emergency
responders and the leading innovators from the world, the event is the hub of the solutions
that provide attendees with tools that they can use to protect the communities and mitigate
the damage from disasters.
Tickets for the event are $119, but we have been given the promo code: HUGI100 that will
enable you to attend the event for FREE!

So don’t miss out and register today: https://shorturl.at/aikrW

And in case you missed it, here is our ultimate road trip playlist is the perfect mix of podcasts, and hidden gems that will keep you energized for the entire journey

-

This website uses cookies to improve your experience. We'll assume you're ok with this, but you can opt-out if you wish. Accept Read More