Animals | Free Full-Text | eDNA-Based Early Detection Illustrates Rapid Spread of the Non-Native Golden Mussel Introduced into Beijing via Water Diversion

By inergency On Jan 26, 2024

[ad_1]

1. Introduction

Owing to a combination of natural and anthropogenic activity-derived stressors, water scarcity has evolved into a significant global challenge, impacting a growing number of regions throughout all continents [1]. By 2025, an estimated 1.8 billion people are anticipated to reside in countries or regions experiencing absolute water scarcity (see United Nations water scarcity at http://www.un.org/waterforlifedecade/scarcity.shtml, accessed on 30 December 2023). The water scarcity crisis is particularly pronounced in densely populated areas, especially mega cities situated in arid or semiarid regions [2]. In order to alleviate water scarcity, water diversion projects have been initiated since the early 19th century, aiming to transfer water from regions of relative abundance to those facing scarcity [3,4].

Multiple mega cities in North China, such as Beijing and Tianjin, are contending with water scarcity due to rapid population growth, urbanization, and climate change [5]. Illustratively, the total per capita water availability in Beijing stands at merely 170 m³ before water diversions, falling significantly below the United Nations’ absolute water scarcity threshold [5]. To foster the sustainable development of these mega cities, the South-to-North Water Transfer Project (SNWTP), the world’s largest water diversion initiative, was initiated on 12 December 2014. The water diversion project has played a crucial role in enhancing the availability and equitable distribution of water resources in North China [6]. As a result, it has provided essential support for rapid and sustainable social and economic development, with a particular focus on the Beijing-Tianjin-Hebei Metropolitan region [6]. Nevertheless, shortly after the commencement of the water diversion project, Zhan and colleagues [5] emphasized that the opening of this water diversion project could construct an “invasion highway”, facilitating the spread of non-native invasive species from the Yangtze River basin and potentially leading to detrimental effects on the recipient aquatic ecosystems in Beijing. Soon after the water diversions; studies have now confirmed that what was anticipated indeed transpired [7]. Non-native species such as fishes, mollusks, aquatic plants, and particularly the highly invasive golden mussel Limnoperna fortune (Figure 1) have been transported through the water diversion project and started to colonize water bodies in Beijing [7,8,9,10].

The golden mussel, presumably considered native to the Pearl River in China, has undergone widespread colonization both domestically and internationally [11]. Due to the lack of trackable records, the invasion pathway and history remain largely unclear in many regions. In China, the golden mussel has expanded its presence to Hong Kong and Taiwan and northward into the Yangtze, Huaihe, Yellow, and Haihe River basins [12,13]. This mussel species has been introduced into several Southeast Asian countries, including Cambodia, Vietnam, Laos, and Thailand, likely before the 20th century [11]. Additionally, it has been introduced to East Asian countries such as South Korea and Japan through shipping and transfers of aquaculture facilities and cultured species [14,15]. In South America, the species was introduced around 1990 through ballast water discharged into the Río de la Plata estuary by transoceanic vessels [16]. Following the initial introduction, the mussel rapidly spread to and successfully colonized in Uruguay, Paraguay, Brazil, and Bolivia [11]. In invaded habitats, this mussel species has caused large-scale biofouling issues on both natural and artificial hard substrates such as rocks and cement structures, reaching extremely high population densities [17,18]. The severe biofouling problems have resulted in significantly negative ecological and economic effects, such as the suppression of local benthic communities and the obstruction of pipes in water and power plants [17,18].

Given the extensive invasion history and economic, ecological, and environmental harms associated with golden mussels, there is a crucial need to develop prevention policies and establish effective management strategies in potentially infested areas. Early detection is especially critical for management of newly introduced non-native species, as it enables a prompt response for possible eradication and control [19,20]. The detection of invasions at an earlier stage can result in more favorable outcomes and reduced economic costs because smaller invasive populations are generally easier and less expensive to manage [21,22]. Technically, the level of rarity of new invaders and success of early detection are predominantly influenced by the strategies employed and their associated sensitivity [23,24,25].

The presence of environmental DNA (eDNA) in environments provides a cost-effective method for early detection of invasive species [23]. By analyzing the eDNA released into the surrounding environment rather than isolating the target organisms themselves, researchers can detect invasive species out of complex biological communities such as those in aquatic ecosystems [23,26]. Furthermore, the combined application of DNA barcoding and eDNA collected from environments has proven to be remarkably effective in detecting the target invasive species at extremely low abundance. For example, a meticulously designed eDNA-based PCR assay can detect the target eDNA at concentrations lower than 10⁻⁶ ng/μL [23,27]. Thus, eDNA-based methods have been demonstrated to be more effective and sensitive tools for early detection of invasive species when compared to conventional methods such as net tow and field surveys in aquatic ecosystems [26,27,28,29]. Owing to these technical advantages, particularly its high sensitivity, eDNA-based early detection has gained popularity in identifying invasive species at an early stage.

The implementation of SNWTP has established an unprecedented invasion highway for the introduction of golden mussels into waterbodies in Beijing. Despite this development, the dynamics of their spread and the resulting ecological impacts remain largely unexplored in newly colonized waterbodies in Beijing. In this study, we employed eDNA-based early detection to pinpoint the presence of newly introduced golden mussels in various water bodies across Beijing. Meanwhile, conventional field surveys were concurrently conducted to validate positive eDNA-based detections. Our objectives are to confirm the successful colonization of golden mussels, scrutinize the geographical extent of their spread post settlement, and demarcate infested areas to facilitate the formulation of effective management strategies.

2. Materials and Methods

Since 2014, our research group has initiated a comprehensive routine surveillance program encompassing all major water bodies in Beijing, including streams, rivers, and reservoirs/ponds. This program entails a thorough assessment of both water quality and biodiversity based on conventional methods [7]. In our biodiversity assessments, the absence of golden mussels was recorded from 2014–2018. However, routine field surveys detected the established populations of golden mussels at four distinct sites in 2019 [7]. Considering that colonizing species typically experience a lag time before reaching a detectable population density, it remains plausible that successful colonization by golden mussels may have occurred earlier than our initial detection in 2019, very likely soon after the operation of SNWTP. To enhance our ability to detect golden mussels at an early invasion stage, we developed eDNA-based methods [29] to conduct comprehensive surveys across all water bodies beginning in 2020.

2.1. eDNA Sampling

As golden mussels live in shallow waters with hard substrates, particularly human-made structures, we sampled eDNA from these areas in each water body from 2020 to 2023 in three seasons: spring, summer, and autumn (Figure 2). At each sampling site, a 1 L water sample was collected using a sterile bottle. The collected replicates (3 × 1 L) from each site were then amalgamated into a single 3 L sample. Subsequently, all collected samples were promptly stored at 4° C and expedited to the laboratory. Within 24 h, all water samples were subjected to filtration on 0.45 μm pore-size mixed cellulose esters (MCE) membranes (Millipore, Cambridge, MA, USA) using a vacuum pump to collect eDNA [30,31]. As a procedural negative control, 3 L of sterile pure water (Milli-Q^®, Bedford, MA, USA) was filtered at each sampling site. All filters containing eDNA, along with the negative controls, were frozen at −80 °C until further treatment.

2.2. eDNA Extraction and PCR

For each sample, the filter was shredded using the well-sterilized scissors, and eDNA was extracted from the shredded membrane using the DNeasy Blood and Tissue Kit (Qiagen) following the manufacturer’s instructions. After eDNA extraction, the concentration and quality of the extracted eDNA were assessed using both the ultraviolet spectrophotometer (NanoDrop, Thermo Scientific Inc., Wilmington, DE, USA) and 2% agarose gel electrophoresis.

Each extracted eDNA sample was amplified using the primer pair B (F: AGAACCCCAGCAGTTGACATAG; R: CCACCTAGAACTGGTAGTGAAACTAAC; amplicon size = 197 bp) derived from the cytochrome c oxidase I (COI) gene specifically developed for eDNA-based surveys for golden mussels [29]. PCR was conducted in a 25 μL mix containing 1 × PCR buffer, 1 μL DNA extract (~10 ng eDNA), 0.05 mM of each dNTP, 0.4 mM of each primer, and 2 U of Taq Polymerase (Takara Bio Inc., Otsu, Japan). Thermocycler conditions included an initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 35 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min. For each sample, five PCR replicates were performed to avoid biased amplifications [32,33,34]. After PCR, we loaded 5 μL of PCR products in each well of 2% agarose gels stained with ethidium bromide and then visualized using an automatic gel image analysis system. The successful detection of golden mussels was accomplished by visualizing the PCR products on agarose gels. A total of 8–10 PCR products were randomly selected for Sanger sequencing (Sangon Biotech Co., Ltd., Shanghai, China) in each year to validate the positive detections.

2.3. Conventional Field Surveys

Across all sampling sites (Figure 2), we executed thorough field surveys focusing on hard substrates, including manmade structures, rocks, and woods, which are conducive to golden mussel colonization. We meticulously examined hard substrates such as stones, where applicable, by flapping to search for mussels. Upon detecting golden mussels, the number of collected individuals was tallied and converted into population density (individuals/m²). Given that all sites were in the early stages of invasions, and mussels were confined to limited substrates, replicates for calculating average population density were not feasible. As the population density was low (see Table 1 below), we collected all found individuals at each site and immediately preserved them in a sterile plastic bottle filled with 100% ethanol (one bottle per site).

For all sites where golden mussels were detected, they were meticulously collected and subsequently subjected to morphological identification. To ensure a doubly confirmed species identification, 2–3 individuals were randomly selected from the collected specimens for molecular identification for each site. All procedures, including DNA extraction and PCR, were performed using the same protocols for eDNA. Following PCR, the obtained products underwent Sanger sequencing (Sangon Biotech Co., Ltd., Shanghai, China) to unequivocally confirm the identity of the species.

5. Conclusions

Shortly after the introduction of golden mussels into Beijing, their rapid spread became evident across diverse water types in four out of the five river basins. In 2023, a significant increase in positive sites was observed, with over 50% of surveyed locations displaying positive results in eDNA-based early detection. Among the investigated river basins, the North Canal River and Yongding River basins have been particularly heavily infested, accounting for over 59% and 63% of positive sites, respectively. To date, only the Daqing River basin remains uninfested. Field surveys lag behind eDNA-based analysis in detecting mussels, with confirmation of adult presence commencing in 2021. By 2023, mussels were identified at more than 10 sites. The overall population density at all positive sites has remained low, ranging from 1 to 30 individuals/m², indicating that the invasions in Beijing are in their early stages. Owing to the swift dissemination and ongoing introductions of substantial propagules through the SNWTP, we anticipate further spread and colonization not only within Beijing but also extending beyond its borders.

Due to the substantial negative ecological and economic repercussions associated with golden mussels, we strongly advocate for the implementation of effective management practices across all five river basins in Beijing and beyond. Recognizing that the management of invasive species is most effective and economical at early stages, we emphasize the necessity for proactive measures. In uninfested waters and areas with potential future infestations, routine early detection, particularly employing eDNA-based methods, should be routinely conducted to facilitate risk assessment and allow managers to explore viable control options [28,53]. For ecosystems already affected by golden mussels, a range of established eradication strategies is available. These strategies include biological control such as predation using fish [2], physical prevention methods such as the use of antifouling materials/coatings and ultraviolet light [2], and chemical eradication using oxidizing chemicals and magnetic nanoparticles [54,55]. The selection of these strategies should be tailored to specific water types (e.g., lotic and lentic systems) and usage scenarios (e.g., diversion channels and natural waters) to effectively control and possibly eradicate the invasive mussels.

Due to the highly invasive nature of golden mussels, any residual propagules post eradication hold the potential to seed viable populations locally and beyond, thereby posing a risk of failure despite extensive management efforts. The timely insights provided by eDNA-based analysis are crucial in addressing the effectiveness of management and eradication efforts. The utilization of eDNA-based detection is especially effective in identifying low levels of propagules post eradication in managed water bodies, where traditional surveys struggle and often fail to detect populations of such minimal size. Therefore, eDNA-based analysis provides an effective means of evaluating eradication and other management outcomes.

[ad_2]